Table 2. Primers used in this study

Target virus	Target gene	Primer	Sequence (5′ to 3′)	Length	Condition	Object	Reference
KHV	Thymidine kinase	TK-F	GGGTTACCTGTACGAG	409	94°C, 5 min, 40 cycles (94°C, 1 min, 55°C, 1 min, 72°C, 1 min), 72°C, 10 min	Detection	Bercovier et al., 2005
		TK-R	CACCCAGTAGAT TATGC	409		Detection	Bercovier et al., 2005
		Enlarged TK gene-F	AACGCGGGCCAGCTGAACAT	1,001	94°C, 5 min, 40 cycles (94°C, 1 min, 58°C, 1 min, 72°C, 1 min), 72°C, 10 min	Sequencing	Kurita et al., 2009
		Enlarged TK gene-R	TGTGTGTATCCCAATAAACG	1,001		Sequencing	Kurita et al., 2009
	SphI-5	Gray sph-F	GACACCACATCTGCAAGGAG	292	94°C, 30 s, 40 cycles (94°C, 30 sec, 63°C, 30 sec, 72°C, 30 sec), 72°C, 7 min	Detection	Gray et al., 2002
	SphI-5	Gray sph-R	GACACATGTTACAATGGTCGC	292		Detection	Gray et al., 2002
	KpnI/SacI fragment	KHV-86f	GACGCCGGAGACCTTGTG	78	50°C, 2 min, 95°C, 10 min, 40 cycles (95°C, 15 sec, 60°C, 60 sec)	Detection and quantification	Gilad et al., 2004
		KHV-163r	CGGGTTCTTATTTTTGTCCTTGTT
		KHV-109p	CTTCCTCTGCTCGGCGAGCACG
CEV	Partial 4a	CEV For B	ATGGAGTATCCAAAGTACTTAG	528	94°C, 3 min, 40 cycles (95°C, 30 sec, 55°C, 30 sec, 72°C, 30 sec), 72°C, 10 min	Detection and sequencing	Matras et al., 2017
CEV	Partial 4a	CEV Rev J	CTCTTCACTATTGTGACTTTG	528		Detection and sequencing	Matras et al., 2017
CyHV-2	Helicase	CyHV-2 HelF	GGACTTGCGAAGAGTTTGATTTCTAC	366	94°C, 5 min, 35 cycles (94°C, 1 min, 60°C, 1 min, 72°C, 1 min), 72°C, 10 min	Detection and sequencing	Waltzek et al., 2009
	Helicase	CyHV-2 HelR	CCATAGTCACCATCGTCTCATC	366		Detection and sequencing	Waltzek et al., 2009
	Marker A	oPVP382	CCACTTAGAGTAACCACTTAGAG	475	94°C, 8 min, 35 cycles (94°C, 30 sec, 58°C, 30 sec, 72°C, 30 sec), 72°C, 10 min	Sequencing	Boitard et al., 2016
	Marker A	oPVP383	GCGTTGACTCATTTGCGGTTTG	475		Sequencing	Boitard et al., 2016

KHV, koi herpesvirus; CEV, carp edema virus; CyHV-2, cyprinid herpesvirus-2.